rs76852785 chr3:102673730 C>A
- Sequence
catcataccccgccccctccctgg[C/A]gtcctggagccaattttctgtacc
- ASB in cell types
- foreskin keratinocyte breast epithelial cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.29 | n/a | 2.33 | |||
| breast epithelial cells | 1.50 | -1.34 | 1.00 |
Items per page:
1 – 2 of 2