rs768878 chr8:102789329 C>T
- Sequence
ctgcctctcccgcactggggactg[C/T]ccccagaagcctgaattgttttca
- ASB in cell types
- HAEC (human aortic endothelial cells)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 1.85 | -1.11 | 2.17 | 1.32 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, hdl cholesterol change with statins, years of education