rs76940860 chr2:18762970 A>G
- Sequence
tttatttagcaaccctatgagtct[A/G]ttgaagtgttggtttagtggtctt
- ASB in cell types
- VCaP (prostate carcinoma) LNCaP (prostate carcinoma) SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | -0.31 | 1.27 | 2.00 | |||
| LNCaP (prostate carcinoma) | 0.91 | -0.14 | 1.86 | |||
| SK-N-SH (neuroblastoma) | -1.11 | 1.26 | 1.50 |
Items per page:
1 – 3 of 3