rs7694471 chr4:177555322 A>G
- Sequence
tcttttgccatgtaggtttaaact[A/G]tgacttagtggtgcaagagaccac
- ASB in cell types
- foreskin keratinocyte K562 (myelogenous leukemia) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.80 | n/a | 2.17 | |||
| K562 (myelogenous leukemia) | -0.26 | 0.63 | 2.00 | |||
| VCaP (prostate carcinoma) | 1.08 | -1.36 | 1.33 |
Items per page:
1 – 3 of 3