rs7694997 chr4:9946187 A>G
- Sequence
aggaaagaaaaggatagtcttgtc[A/G]gccaaggtgatttttaactcccag
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.09 | -0.09 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, gout, infant head circumference, serum urate, tetrology of fallot, uric acid, variant creutzfeldt-jakob disease
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cortex, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Muscle_Skeletal, Pancreas, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood