rs7702150 chr5:1168997 A>G
- Sequence
tgtggtcttgatttgtatccaacc[A/G]gacgtttaatatccgagaccgtgc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.40 | 0.99 | 1.31 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hypertension (early onset hypertension), parkinsons disease, serum creatinine, sporadic creutzfeldt-jakob disease, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Spleen, Stomach, Thyroid