rs770940 chr6:16837775 T>C
- Sequence
ttatcatcttagtgcttcctgtta[T/C]actcatagccaaaggagagggtgg
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.27 | 0.80 | 1.34 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, body mass index (bmi), ldl cholesterol change with statins, total brain volume (excluding patients with neuropsychiatric disorders), total cholesterol change with statins, triglycerides