rs7711011 chr5:173535504 G>C
- Sequence
atgtgttttggatgcccaaagtca[G/C]acactcattcattttaaaaagaaa
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) T47D (invasive ductal carcinoma) ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.13 | -0.32 | 2.69 | |||
| T47D (invasive ductal carcinoma) | -0.75 | 1.40 | 2.53 | |||
| ZR-75-1 (invasive ductal carcinoma) | -1.21 | 1.89 | 2.67 |
Items per page:
1 – 3 of 3