rs771840 chr12:77601202 A>T
- Sequence
tattatctgcatttcaggtgagat[A/T]actgaagcttagacaggggaagtg
- ASB in cell types
- D283 Med (medulloblastoma)
- ASB for transcription factors
- NDF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NDF1_HUMAN | -0.57 | 1.45 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder in alcoholics, bipolar disorder in non-alcoholics, chronic kidney disease, irritible bowel syndrome, lp-pla2 mass, personality disorders (pd) - cluster c, salmonella-induced pyroptosis, total cholesterol, triglycerides, waist hip ratio