rs772550 chr12:62909404 A>G
- Sequence
agcagccactggcctcagccatct[A/G]atctcctctggaccctcatttcct
- ASB in cell types
- K562 (myelogenous leukemia) HUES64 (embryonic stem cells) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.83 | 1.33 | 3.37 | |||
| HUES64 (embryonic stem cells) | 1.52 | -1.43 | 1.33 | |||
| HEK293 (embryonic kidney) | 0.39 | -0.17 | 2.01 |
Items per page:
1 – 3 of 3