rs7727189 chr5:79858291 G>C
- Sequence
actgggtaccttcaaaagttgcac[G/C]agtttgtgtgcagcactgccctct
- ASB in cell types
- erythroid cells kidney lower leg skin
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 3.04 | n/a | 2.00 | |||
| kidney | 2.02 | -3.95 | 2.50 | |||
| lower leg skin | 1.84 | n/a | 1.50 |
Items per page:
1 – 3 of 3