rs772816 chr3:149085892 A>G
- Sequence
atgcgttttccttgcaagtggcgc[A/G]tatctctactagcgcctctgcaaa
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts neural cell
- ASB for transcription factors
- TAL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TAL1_HUMAN | 1.78 | -0.01 | 1.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Thyroid