rs7736759 chr5:159965849 A>T
- Sequence
ctgaatttatttatttatttattt[A/T]tttttttgacacagaccaggctgt
- ASB in cell types
- MCF10A (breast epithelial cells) MCF10AT1 (breast premetastatic epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10A (breast epithelial cells) | n/a | 2.57 | 2.00 | |||
| MCF10AT1 (breast premetastatic epithelial cells) | -1.94 | 2.25 | 2.00 |
Items per page:
1 – 2 of 2