rs7740861 chr6:8219679 A>G
- Sequence
ggagatatttatttttcttattct[A/G]aagaatactcatcaggtaccatta
- ASB in cell types
- foreskin keratinocyte K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.95 | n/a | 2.33 | |||
| K562 (myelogenous leukemia) | 0.67 | -0.71 | 2.97 |
Items per page:
1 – 2 of 2