rs7742303 chr6:46848981 T>A
- Sequence
attcctggtttctgttatccacta[T/A]gccttgaccttcgctctgtccata
- ASB in cell types
- foreskin keratinocyte GM12878 (female B-cells) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.50 | n/a | 2.17 | |||
| GM12878 (female B-cells) | 0.83 | 0.30 | 1.34 | |||
| HepG2 (hepatoblastoma) | 0.62 | 0.03 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Left_Ventricle, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid