rs77567403 chr6:6007226 C>G
- Sequence
tagcggtcacccctgcctcttcct[C/G]gttccgggggccccccagccccgc
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- ELF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | -2.77 | 2.50 | 1.33 | 2.71 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
