rs776 chr2:18404749 T>C
- Sequence
gtgatagtgggagggaagtgggag[T/C]ggaaagcttgttcttaatgtctgt
- ASB in cell types
- H929 (plasma cell myeloma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 2.43 | -2.74 | 1.33 | |||
| foreskin keratinocyte | 1.68 | -0.84 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), antidepressant drug treatment outcome in depression, height, ldl cholesterol change with statins