rs776105 chr3:77693258 G>A
- Sequence
aatgacattgtcttcagaatcaga[G/A]gagtgcaatactaggcacttggca
- ASB in cell types
- breast tumor tissue
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor tissue | 1.23 | -0.38 | 2.08 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, bipolar disorder, hdl cholesterol, late onset alzheimers disease, mitral annular calcium, total cholesterol