rs776106 chr3:77693400 C>A
- Sequence
tgctctggcagcagtcatctaagt[C/A]aatttcccagcacctgcaaatatt
- ASB in cell types
- breast tumor tissue ZR-75-1 (invasive ductal carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 0.42 | 1.58 | 1.60 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, cisplatin ic50 in b lymphoblastoid cell lines, hypertension (early onset hypertension), late onset alzheimers disease, ldl cholesterol, longstanding arthritis, obesity with early age of onset (age >2), rheumatoid arthritis, tetrology of fallot, triglycerides, triglycerides change with statins