rs7761103 chr6:14664760 G>T
- Sequence
taagggcgcagtcctttgaaacac[G/T]tgtaagtcagcaaaaggcacccag
- ASB in cell types
- GM12878 (female B-cells) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.79 | 0.27 | 1.33 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.55 | 0.47 | 1.40 |
Items per page:
1 – 2 of 2