rs7761500 chr6:13916909 G>A
- Sequence
aaaaaaagttattttaaggacatg[G/A]ctattttacagcatccaagggcag
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.65 | -0.53 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, diabetic retinopathy in type 2 diabetes mellitus, hip bone mineral density (bmd), infant head circumference, irritible bowel syndrome, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Caudate_basal_ganglia, Brain_Substantia_nigra, Breast_Mammary_Tissue, Lung, Nerve_Tibial, Ovary, Skin_Sun_Exposed_Lower_leg, Spleen, Whole_Blood