rs7765813 chr6:25624167 G>T
- Sequence
ggagaaggctccgttcactgaaat[G/T]ggccataatttaatctgctggtgc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NFIC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFIC_HUMAN | 2.22 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP coronary artery disease (cad), diastolic blood pressure (dbp), height, hemoglobin (hb), ldl cholesterol, mean corpuscular hemoglobin (mch), mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), parkinsons disease, serum creatinine, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Vagina