rs7769473 chr6:162250273 G>A
- Sequence
aactagatgtccttttggtgcagc[G/A]ttgagcttgttttcctattggcag
- ASB in cell types
- LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -0.25 | 0.95 | 1.36 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, diastolic blood pressure (dbp), infant head circumference, parkinsons disease