rs77759750 chr19:57099404 G>T
- Sequence
gaccgccatcgccgctggacgtca[G/T]ggccgccaggcccagcgagatgtc
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.79 | -0.03 | 2.00 | |||
| HepG2 (hepatoblastoma) | 0.54 | 0.31 | 1.24 | |||
| CD34+ stem cells-derived erythroblasts | 1.43 | n/a | 2.50 |
Items per page:
1 – 3 of 3