rs77762177 chr16:84726223 G>T
- Sequence
tgtgctgcagcgccccctagtgcc[G/T]tgctgtactgatagtccccagcgt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) A549 (lung carcinoma) HEK293 (embryonic kidney) epidermal keratinocytes
- ASB for transcription factors
- SMC3_HUMAN CLOCK_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | 0.92 | -0.26 | 2.00 | n/a | n/a | |||
| CLOCK_HUMAN | 1.84 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2