rs7783715 chr7:1883749 T>C
- Sequence
ggtccaggctcagagggcagtctg[T/C]gtgccccaggccgtattaaaagga
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.68 | -0.16 | 1.96 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, comorbid depressive syndrome and alcohol dependence, diastolic blood pressure (dbp), eye color, fibrotic idiopathic interstitial pneumonias (pulmonary fibrosis), irritible bowel syndrome, ldl cholesterol, microalbuminuria, tetrology of fallot, total cholesterol, triglycerides, urinary albumin-to-creatinine ratio
GTEx eQTL Brain_Nucleus_accumbens_basal_ganglia, Heart_Atrial_Appendage, Spleen, Testis, Whole_Blood