rs778378 chr1:228978818 C>T
- Sequence
aaaagcatgtcccagccagcagcc[C/T]gccttctctctgctcagtgtcttc
- ASB in cell types
- MDA-MB-453 (breast adenocarcinoma) HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-453 (breast adenocarcinoma) | -0.55 | 1.63 | 3.00 | |||
| HEK293 (embryonic kidney) | -0.55 | 0.53 | 3.64 | |||
| HEK293T (embryonic kidney) | -0.90 | 1.10 | 2.14 |
Items per page:
1 – 3 of 3