rs7787246 chr7:22082889 A>G
- Sequence
caaatccaggtttctccctgcttc[A/G]ccaaaaggccccctgcctccaccg
- ASB in cell types
- MDA-MB-453 (breast adenocarcinoma) erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-453 (breast adenocarcinoma) | 2.14 | 0.26 | 1.33 | |||
| erythroid cells | 1.61 | n/a | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, eye color, hdl cholesterol, rheumatoid arthritis, stabilized warfarin dose