rs7787802 chr7:22082945 G>T
- Sequence
aacagtctctgtctgggaactgcg[G/T]ttgcctaaggctcggtttgctctt
- ASB in cell types
- MDA-MB-453 (breast adenocarcinoma) erythroid cells PC9 (lung adenocarcinoma) BE2C
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.33 | -0.20 | 1.39 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, microalbuminuria, rheumatoid arthritis