rs778812 chr19:5822495 C>T
- Sequence
ccagacggcgtcgagtgtggtggg[C/T]gtgtacacgtgagttattaaacac
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZIC2_HUMAN ZFHX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZIC2_HUMAN | 2.22 | -2.06 | 2.00 | n/a | n/a | |||
| ZFHX2_HUMAN | 1.87 | -1.70 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Mucosa, Heart_Atrial_Appendage, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis