rs77946093 chr16:397562 G>T
- Sequence
ctgcaggcgcccggcgagttggca[G/T]cctgggcgggtccggggcgaccga
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- SP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SP2_HUMAN | -2.06 | 2.29 | 2.00 | -2.17 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
