rs77967975 chr20:35741258 T>G
- Sequence
atgttgatgaggttggtctcgaac[T/G]cctaacctcaagtgatccgcctgc
- ASB in cell types
- HepG2 (hepatoblastoma) HEK293 (embryonic kidney)
- ASB for transcription factors
- ZNF24_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZNF24_HUMAN | -0.03 | 1.36 | 1.44 | n/a | n/a |
Items per page:
1 – 1 of 1