rs7802002 chr7:114852027 A>T
- Sequence
tgagagtgttagaagttccaacca[A/T]taaatctagttctcaatcaactat
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- FEZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FEZF1_HUMAN | 2.14 | -1.70 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, cystatin c in serum, hdl cholesterol change with statins, ldl cholesterol change with statins, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Heart_Atrial_Appendage, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Testis