rs7804584 chr7:151948175 A>T
- Sequence
tatgtgtgtatgtgtatgcgtgta[A/T]tgtgtgtatgtatgtgtgtgtgaa
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.31 | 0.50 | 1.52 | |||
| HepG2 (hepatoblastoma) | 0.81 | 0.50 | 1.39 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, cystatin c in serum, hdl cholesterol change with statins