rs78067620 chr9:137240621 G>T
- Sequence
tccaccgccgcagcccccgagccc[G/T]tgtatcttcctgcctttaaggcat
- ASB in cell types
- GM12878 (female B-cells) breast tumor tissue
- ASB for transcription factors
- CTCF_HUMAN FOXA1_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.86 | 0.13 | 1.31 | n/a | No Hit | |||
| FOXA1_HUMAN | -1.65 | 1.59 | 1.33 | n/a | No Hit | |||
| ESR1_HUMAN | 1.52 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood