rs78140146 chr11:2151575 G>T
- Sequence
agaaatctgctacaccaagctttc[G/T]ccatttagcctcttaagtggcctt
- ASB in cell types
- HCT-116 (colon carcinoma) RWPE1 (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | 1.58 | 0.04 | 1.22 | |||
| RWPE1 (prostate epithelial cells) | -1.38 | 1.16 | 1.33 |
Items per page:
1 – 2 of 2