rs7815609 chr8:2086999 C>A
- Sequence
agacgttgtatattgcagttctgc[C/A]atcacgtatatgtatgtaacctac
- ASB in cell types
- A549 (lung carcinoma) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.75 | 0.24 | 1.69 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, maternal transmission distortion, plasma brain natriuretic peptide (bnp), transmission distortion, triglycerides, years of education