rs7819437 chr8:125643860 G>A
- Sequence
taaagacagctaatgagagactga[G/A]tgggtcccagtatgatgcagtcat
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.66 | 0.01 | 1.52 | |||
| A549 (lung carcinoma) | -0.35 | 1.03 | 1.17 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, total cholesterol change with statins, triglycerides, urinary albumin-to-creatinine ratio