rs782584 chr2:55693981 C>G
- Sequence
tacgaagactagagagggtcaaac[C/G]tatcagaacgcgattatgttgcaa
- ASB in cell types
- fetal bone marrow-derived mononuclear cells GM12878 (female B-cells) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- KMT2A_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KMT2A_HUMAN | 2.52 | n/a | 1.50 | n/a | n/a | |||
| FOXK2_HUMAN | 1.38 | -1.63 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), hdl cholesterol, ldl cholesterol, systolic blood pressure (sbp), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood