rs783026 chr15:31129473 T>C
- Sequence
actcagctctctgctgcccccacc[T/C]ggccgcctccagtgccgacctgat
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte HeLa S3 (cervical adenocarcinoma) lymphoblastoid cells
- ASB for transcription factors
- SMC3_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | 0.97 | 0.70 | 1.75 | n/a | n/a | |||
| CTCF_HUMAN | 0.93 | 0.55 | 1.53 | -1.36 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP adiponectin levels, aortic valve calcium, common carotid artery thickness (average of near and far wall measures), obesity with early age of onset (age >2), salmonella-induced pyroptosis, serum creatinine, sporadic creutzfeldt-jakob disease