rs783149 chr6:160667886 C>A
- Sequence
agcacctcactccagaggccagct[C/A]agctcaatctgggcagagctgcat
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.20 | -0.35 | 1.72 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, hdl cholesterol (female), hdl cholesterol (male), total cholesterol, triglycerides