rs7836028 chr8:120030121 G>T
- Sequence
ccatatcctcgtaagcctgggggt[G/T]catgggtgtcccctgccttggcca
- ASB in cell types
- cranial neural crest cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| cranial neural crest cells | 1.48 | -0.86 | 2.00 |
Items per page:
1 – 1 of 1