rs7842666 chr8:27772635 G>A
- Sequence
actcgcggcggccgcctggccccc[G/A]gaactcctccgtgcacttccggcg
- ASB in cell types
- HEK293 (embryonic kidney) A549 (lung carcinoma) liver HCT-116 (colon carcinoma)
- ASB for transcription factors
- GABPA_HUMAN JUN_HUMAN ZN335_HUMAN ZNF76_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GABPA_HUMAN | 1.88 | -0.62 | 1.56 | -4.29 | Concordant | |||
| JUN_HUMAN | 1.05 | -0.10 | 1.78 | n/a | No Hit | |||
| ZN335_HUMAN | n/a | 2.33 | 2.00 | n/a | No Hit | |||
| ZNF76_HUMAN | -1.52 | 1.31 | 1.33 | n/a | No Hit | |||
| ZBT20_HUMAN | -1.79 | 2.22 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Liver, Muscle_Skeletal, Nerve_Tibial, Pancreas, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood