rs78506 chr22:33018179 G>A
- Sequence
aggagccagacaggttagaaggcc[G/A]ttgtagtcattttggtccacagat
- ASB in cell types
- PC9 (lung adenocarcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.36 | 0.97 | 1.49 | n/a | No Hit |
Items per page:
1 – 1 of 1