rs785206 chr2:190184728 T>C
- Sequence
aggggaaagggtgctgggtggaga[T/C]aaaggcgaggtggtgtgtttcaac
- ASB in cell types
- CD34+ bone marrow cell-derived erythroid progenitors
- ASB for transcription factors
- TAL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TAL1_HUMAN | 1.87 | -1.55 | 1.50 | -8.17 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
