rs7853822 chr9:133160987 G>A
- Sequence
tcacgccactgcactccagccagg[G/A]cgacagagtgagactctgactcaa
- ASB in cell types
- upper lobe of left lung Peyer's patch adrenal gland
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.51 | 1.22 | 1.38 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Heart_Atrial_Appendage, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg