rs7864648 chr9:16368734 G>T
- Sequence
ttttacactggaagaaactgagaa[G/T]caaactggtaacttgcccaaggtc
- ASB in cell types
- SK-BR-3 (breast adenocarcinoma)
- ASB for transcription factors
- ERR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ERR1_HUMAN | 1.71 | -0.67 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP height, infant head circumference, irritible bowel syndrome, longstanding arthritis, rheumatoid arthritis, schizophrenia, sporadic creutzfeldt-jakob disease, variant creutzfeldt-jakob disease
PheWAS abnormal electrocardiogram, abnormal serum enzyme levels, abnormal sputum, acne, acquired absence of breast, alcohol-related disorders, alcoholism, aphakia and other disorders of lens, benign neoplasm of other parts of digestive system, benign neoplasm of respiratory and intrathoracic organs, cardiac arrest, cardiac arrest & ventricular fibrillation, cardiac conduction disorders, cardiac dysrhythmias, cardiomegaly, cellulitis and abscess of arm, chronic hepatitis, circumscribed scleroderma, complex regional/central pain syndrome, complications of transplants and reattached limbs, contracture of joint, cornea replaced by transplant, costochondritis, decreased libido, dementia with cerebral degenerations, digestive congenital anomalies, disorders of choroid, disorders of mineral metabolism, elevated blood pressure reading, esophageal atresia/tracheoesophageal fistula, essential hypertension, femoral hernia, hemoptysis, hypercalcemia, hypertension, ileostomy status, iron metabolism disorder, joint/ligament sprain, mastoiditis, methicillin resistant staphylococcus aureus, muscular wasting and disuse atrophy, nephritis and nephropathy in diseases classified elsewhere, nephritis and nephropathy without mention of glomerulonephritis, nephritis, nephrosis, renal sclerosis, nonsenile cataract, obesity, open wounds of extremities, optic atrophy, other dyschromia, other specified cardiac dysrhythmias, pityriasis, posttraumatic stress disorder, posttraumatic wound infection, premature beats, pseudoexfoliation glaucoma, sexually transmitted infections, supraventricular premature beats, type 1 diabetic retinopathy, upper gastrointestinal congenital anomalies, uterine cancer, viral pneumonia