rs78667921 chr1:245153204 C>T
- Sequence
cccaccaaacacgctttgggcccc[C/T]agctacttagaaatgcaaatcaga
- ASB in cell types
- upper lobe of left lung erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| upper lobe of left lung | -1.20 | 1.37 | 1.00 | |||
| erythroid progenitors | 1.81 | -1.39 | 2.00 |
Items per page:
1 – 2 of 2