rs78933628 chr16:66380745 A>G
- Sequence
tggtggtggtggtagtgatggtaa[A/G]ggggaaggtggtggttgtgatagt
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.91 | 0.07 | 1.76 | |||
| HepG2 (hepatoblastoma) | 0.77 | -0.09 | 2.00 | |||
| GM12878 (female B-cells) | 1.84 | n/a | 1.50 |
Items per page:
1 – 3 of 3