rs789530 chr11:131688208 C>G
- Sequence
ccccgagccgcgaggctgcctcca[C/G]cgagctggagaacaggctcccggg
- ASB in cell types
- A673 (Ewing sarcoma) erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A673 (Ewing sarcoma) | -2.87 | 2.16 | 1.50 | |||
| erythroid progenitors | 1.81 | -3.74 | 2.50 |
Items per page:
1 – 2 of 2